Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 151 (2005), 2551-2561; DOI  10.1099/mic.0.28048-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Tables
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bolotin, A.
Right arrow Articles by Ehrlich, S. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bolotin, A.
Right arrow Articles by Ehrlich, S. D.
Agricola
Right arrow Articles by Bolotin, A.
Right arrow Articles by Ehrlich, S. D.
Microbiology 151 (2005), 2551-2561; DOI  10.1099/mic.0.28048-0
© 2005 Society for General Microbiology

Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin

Alexander Bolotin, Benoit Quinquis, Alexei Sorokin and S. Dusko Ehrlich

Génétique Microbienne, Institut National de la Recherche Agronomique, Domaine de Vilvert, 78352 Jouy en Josas CEDEX, France

Correspondence
Alexander Bolotin
bolotine{at}jouy.inra.fr


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Numerous prokaryote genomes contain structures known as clustered regularly interspaced short palindromic repeats (CRISPRs), composed of 25–50 bp repeats separated by unique sequence spacers of similar length. CRISPR structures are found in the vicinity of four genes named cas1 to cas4. In silico analysis revealed another cluster of three genes associated with CRISPR structures in many bacterial species, named here as cas1B, cas5 and cas6, and also revealed a certain number of spacers that have homology with extant genes, most frequently derived from phages, but also derived from other extrachromosomal elements. Sequence analysis of CRISPR structures from 24 strains of Streptococcus thermophilus and Streptococcus vestibularis confirmed the homology of spacers with extrachromosomal elements. Phage sensitivity of S. thermophilus strains appears to be correlated with the number of spacers in the CRISPR locus the strain carries. The authors suggest that the spacer elements are the traces of past invasions by extrachromosomal elements, and hypothesize that they provide the cell immunity against phage infection, and more generally foreign DNA expression, by coding an anti-sense RNA. The presence of gene fragments in CRISPR structures and the nuclease motifs in cas genes of both cluster types suggests that CRISPR formation involves a DNA degradation step.


Abbreviations: COG, clusters of orthologous groups; CRISPR, clustered regularly interspaced short palindromic repeat

The GenBank/EMBL/DDBJ accession numbers for the sequences reported in this paper are DQ072985–DQ073008.

Two tables showing the homology of the spacers with database sequences are available as supplementary material with the online version of this paper.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Genomic sequencing revealed the existence of short direct repeats, 25–50 nucleotides long, interspaced by unique sequences of similar size, in bacterial and archaeal genomes (van Belkum et al., 1998Down). These elements were proposed to form a family, known as CRISPRs, clustered regularly interspaced short palindromic repeats (Jansen et al., 2002Down). CRISPR loci show a high level of polymorphism in different strains, and this property had been used for identification of clinical isolates of Mycobacterium tuberculosis (Groenen et al., 1993Down; Kamerbeek et al., 1997Down), Streptococcus pyogenes (Hoe et al., 1999Down) and Campylobacter jejuni (Schouls et al., 2003Down). Four genes, designated cas1 to cas4, were found adjacent to CRISPR loci in different bacteria, suggesting a functional relationship with repeated sequences (Jansen et al., 2002Down). Cas3 and Cas4 have motifs characteristic for helicases of superfamily 2, and the recB exonuclease family, respectively. However, the mechanism of CRISPR structure formation, and the biological function of CRISPRs are not known. Recently, it has been reported that CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA (Pourcel et al., 2005Down). We report here that many spacers have homology with known genes, most often derived from extrachromosomal elements such as phages and plasmids. We propose that the formation of CRISPR structures involves DNA fragmentation by cas genes, and that the apparent stability and widespread presence of CRISPRs in bacterial genomes may be due their protective function against foreign DNA invasion.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial strains and DNA preparation.
Bacterial strains used in this study are listed in Table 1Down. The phage-resistance profile of some strains has been obtained from different sources (Fayard 1993Down; M.-C. Chopin, Génétique Microbienne, Institut National de la Recherche Agronomique, personal communication). Streptococcus thermophilus cells were grown in M17 medium (Terzaghi & Sandine, 1975Down) supplemented with 1 % (w/v) lactose at 42 °C in anaerobic conditions. Chromosomal DNA was extracted as described by Simpson et al. (1993)Down.


View this table:
[in this window]
[in a new window]
 
Table 1. Homology of CRISPR spacers with microbial genes

 
CRISPR locus amplification and sequencing.
The CRISPR locus was identified using the complete sequence of S. thermophilus CNRZ1066 (Bolotin et al., 2004Down). The primers for PCR amplification were selected from regions 207 bp upstream (yc70, TGCTGAGACAACCTAGTCTCTC) and 214 bp downstream (yc31, GCAACGACAGGAAGCGACCAAA) of the identified CRISPR locus. These primers were used for PCR with an annealing temperature 55 °C. The primers yb82, TACTCTCAAGATTTAAGTAACTGTAC, corresponding to the ‘direct’ strand of CRISPR, and yb83, GTACAGTTACTTAAATCTTGAGAGTA, corresponding to the ‘reverse’ strand were also used for testing of presence of repeats.

The complete sequences of PCR-amplified fragments corresponding to different CRISPR loci were obtained by primer walking. The sequences of these primers can be provided upon request to A. B. For sequence analysis the loci were divided into direct repeats and corresponding spacer sequences. These were named using acronyms composed of the strain identifier followed by a one letter descriptor (‘d’ for the repeats and ‘s' for spacers), and a number referring to the position of the element within the locus.

Spacer sequences were analysed for homology against themselves and the NCBI entrez nucleotide sequence database. CLUSTAL (Higgins & Sharp, 1989Down) software was used for sequence alignment.

Nucleotide and protein sequences.
Nucleotide sequences of CRISPR loci of different bacterial strains were obtained from the NCBI (www.ncbi.nlm.nih.gov) database, corresponding accession nos are given in parentheses after the strain systematic name. cas genes sequences were obtained from NCBI, MBGD (http://mbgd.genome.ad.jp) and ERGO (http://ergo.integratedgenomics.com/ERGO) databases. Assignment of the genes was based on sequence conservation, the MBGD COG (clusters of orthologous groups) database and proximity on the genome, determined in most cases by using the ‘pinned region’ function of ERGO or the genome comparison facility of MBGD.

GenBank sequence accession nos.
Nucleotide sequences were deposited in GenBank under the accession nos DQ072985–DQ073008.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The S. thermophilus CRISPR locus and associated genes
Analysis of S. thermophilus CNRZ1066 complete genome sequence (Bolotin et al., 2004Down) revealed a locus of 2·7 kb, having a typical CRISPR organization (Mojica et al., 2000Down): 42 repeats of 36 bp, GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC, separated by unique sequence spacers of 30 bp (Fig. 1Down). The locus contains two duplications: one of five repeats and five spacers, and the other of one repeat and one spacer.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1. The CRISPR locus in the S. thermophilus strain CNRZ1066. Repeats and spacers are shown as grey boxes and triangles, respectively, the duplicated spacers are shown as larger triangles, ORFs are represented as arrows (shaded for ORFs that have homologues in other genomes) and their designation in the S. thermophilus genome is given above the arrows. The numbers indicate the distance from the replication origin (in kb).

 
A gene localized upstream of the locus, str0658, encodes a homologue of the Cas1 protein, which is invariably associated with CRISPR repeats (Jansen et al., 2002Down), but the three other CRISPR-associated genes, cas2, cas3 and cas4, are absent. However, our analysis revealed that str0658 and the two flanking genes, str0657 and str0659, which we term herewith cas5 and cas6, respectively, have homologues that are clustered in numerous bacterial species, belonging to widely divergent phylogenetic groups (Fig. 2aDown). Remarkably, the homologues of the cas1 gene are associated either with the cas2, cas3 and cas4 homologues, or with the cas5 and cas6 homologues, but never with both (Fig. 2aDown). Furthermore, the cas1 genes group in two clusters, cas1A and cas1B (Fig. 2bDown); the former is always associated with cas2, cas3 and cas4, and the latter with cas5 and cas6 genes. Both types of gene (cas1A and cas1B) are present in some species (S. pyogenes, Fusobacterium nucleatum), but each clusters with other members of the corresponding subgroup (Fig. 2bDown). Previous analysis of cas1 genes, referred to as COG 1518 (Makarova et al., 2002Down), placed the seven members of the cas1B subgroup that were available at the time on a clearly separated branch of the phylogenetic tree.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 2. Distribution of cas genes in microbial genomes. (a) Two families of cas clusters. The genes were identified in the ERGO and MBGD databases. The cas2 genes of Aquifex aeolicus (aq_xxx) and P. horikoshii (phyyy and phxxx) were not annotated in the databases but have been reported (Jansen et al., 2002Down). (b) Clustering of cas1 genes into two families. The neighbour-joining facility of CLUSTALW was used for tree construction. (c) Association of the cas1A cas5 cas6 gene cluster with CRISPR structures. Genes are indicated by arrows, CRISPR structures by black boxes and the position of the incomplete repeat is indicated by a triangle, placed above or below the gene line to denote the repeat is in the same or the opposite orientation, respectively, to that of the repeats present in the CRISPR structures. The genes from the ERGO database are shown.

 
cas1B, cas5 and cas6 genes are localized downstream of the CRISPR cluster (illustrated in Fig. 2cUp for the genomes accessible in the ERGO database). A truncated repeat in the orientation opposite to that found within the CRISPR structure is often present upstream of the cluster (Fig. 2cUp). Clustering of the cas1, cas5 and cas6 genes (referred to as COG 1518, COG 3513 and COG 3512, respectively) in four bacterial genomes was previously noticed (Makarova et al., 2002Down), but the association of the cluster with CRISPR structures was not reported.

The Cas5 family groups large proteins (>1100 aa) that carry an HNH motif present in various nucleases, including colicin E9, which causes cell death by introducing double-stranded breaks into DNA, and a number of restriction enzymes (Walker et al., 2002Down; Maté & Kleanthous, 2004Down; Saravanan et al., 2004Down). The Cas6 family groups short proteins (~100 aa) of high pI, the features found in the Cas2 (short) and Cas1 (high pI) families, but there is no sequence homology between Cas6 and other proteins in the databases.

CRISPR spacers have homology with extant genes
CRISPR loci were found close to cas1 genes in about 50 of the 198 complete genomes available in the NCBI database. They totalled 2156 spacers, 44 of which are homologous to other genes, in addition to those from S. thermophilus and Streptococcus vestibularis, described in detail below. The 44 spacers are carried in 4 archaeal and 10 bacterial species, spanning a broad phylogenetic range (Table 1Up). Most (29 out of 44) are homologous to phage genes, even if they were identified on complete genomes (see Supplementary Table 1Up available with the online journal for a detailed analysis). A striking case is that of S. pyogenes, which carries two short CRISPR structures close to the cas1A and cas1B genes, containing three and six spacers, respectively. All spacers of the former, and five of the latter are homologous to S. pyogenes prophage genes.

About a third of the 44 spacers are homologous with genes with no obvious extrachromosomal origin. Remarkably, six of these share homology with genes that reside in the vicinity of extrachromosomally derived genes, three share homology with genes of aberrant G+C content (up to 59 mol% G+C, compared to 47 mol% G+C over the entire Porphyromonas gingivalis W83 genome) and two share homology with genes from regions where the gene order differs from that of phylogenetically close genomes (Clostridium tetani E88). Horizontal transfer could lead to the gene organization observed in all these cases.

CRISPR alleles in different S. thermophilus strains
To further examine the finding that CRISPR spacers can have phage origin, or more generally extrachromosomal origin, we analysed the CRISPR alleles of 22 S. thermophilus and 2 S. vestibularis strains. This was prompted by the consideration that phages of lactic acid bacteria are among the best characterized in respect of genome data (Brussow & Hendrix, 2002Down), and that lactic acid bacteria are exposed frequently to phage attacks under the conditions of dairy fermentations.

PCR reactions with primers homologous to two regions flanking the CRISPR structure (yc70 and yc31) yielded a single band of varying lengths for different strains (Fig. 3Down). The PCR products were sequenced, and the results are summarized in Table 2Down. The number of repeats varied between 10 and 51 for different CRISPR alleles. The repeats were strictly identical, with the exception of 38 out of a total of 632 (6 %). The slightly divergent repeats (less than 3 out of 36 bp difference) were mostly situated in the last position of an allele. The length of spacers comprised between 28 and 32 bp, being 30 for 556 of the 618 spacers (90 %). The total length of the CRISPR loci (from the first nucleotide of the first repeat to the last nucleotide of the last repeat) varied between 628 and 3404 bp. Three identical CRISPR loci were present in more than one strain (groups A, B and C, found in five, two and two strains, respectively; Table 2Down). Internal duplications were detected in almost a quarter of the loci, indicating a substantial level of recombination in CRISPR structures.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Identification of the CRISPR locus in S. thermophilus and S. vestibularis. PCR was carried out with primers yc31 and yc70, and the products were analysed by gel electrophoresis. Strain designation is indicated above the lanes, and details are given in Table 2Up.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Streptococcus strains and their CRISPR loci

 
The 519 spacers of the 20 different CRISPR loci were compared, and 349 (70 % of the total) were found to be unique. At least one example of each unique spacer must have been acquired in a separate event, presumably involving a CRISPR-specific mechanism (see below). In contrast, the identical spacers present in different strains could have been transferred laterally from a donor to a recipient strain, and integrated at a CRISPR locus of the recipient strain by general homologous recombination. The number of spacers common to different strains is summarized in Table 3Down.


View this table:
[in this window]
[in a new window]
 
Table 3. Relations between CRISPR alleles from different S. thermophilus strains

The number of spacers common to the displayed strains is shown.

 
S. thermophilus spacers are homologous to extrachromosomal elements
Out of 349 unique spacers some 124 (36 %) had significant matches (E<0·001) with sequences in the NCBI nucleotide database. The best matches were with phages of streptococci (75 %), and plasmids of S. thermophilus or Lactococcus lactis (20 %). A list of the spacers that have 100 % identity to regions of phages and plasmids is presented in Supplementary Table 2Up, available with the online journal. Different CRISPR alleles had spacers matching different phages; the number of matching spacers at different alleles was between 0 and 21 (Table 2Up). No particular phage region was found to match the spacers, as illustrated for the phage Sfi21 (Fig. 4Down) and also found for other fully sequenced phages (data not shown). The order of spacers within a CRISPR allele did not correspond to the order of matching regions along the phage genome. However, spacers were homologous predominantly with one of the phage strands, as illustrated for Sfi21 (Fig. 4Down) and also found for all fully sequenced phages, where the bias for 27 unique spacers strictly identical with phage sequences was about 3·5 to 1 (21 to 6). As this strand is predominantly coding, the orientation of the spacers relative to the phage ORFs was biased to a similar extent (3·4 to 1; 17 of the 22 unique spacers homologous to an ORF had an orientation corresponding to that of the ORF; Table 3Up).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4. Localization of spacer-matching sequences along the phage Sfi21 genome. The phage genetic map is drawn after GenBank entry NC_000872 (ORFs are shown as arrows), the regions involved in different stages of phage development, identified by comparative analysis (Desiere et al., 2002Down), are indicated above the map, and the scale (in kb) below it. Phage regions having a BLAST E score <0·001 with the CRISPR spacers are indicated by the diamonds placed above or below the map, denoting homology with the top or the bottom DNA strand, respectively.

 
Alignment of 70 bp regions from extrachromosomal elements that comprised 30 bp of 100 % homology with a spacer revealed no similarities other than a 5 bp degenerate sequence, Pu-py-A-A-a, situated downstream from the spacer-matching stretch (Fig. 5Down). It might be significant that this sequence matches the end of the S. thermophilus repeat (...ACAAC), with the exception of the very terminal base, and that it is purine-rich, as are the corresponding ends of CRISPR repeats from many other organisms, having a consensus ...GAAAC (Mojica et al., 2000Down).



View larger version (87K):
[in this window]
[in a new window]
 
Fig. 5. The consensus sequence adjacent to a CRISPR spacer-matching DNA stretch. The top part of the figure shows an alignment of DNA regions of different phages and plasmids containing a region identical with a CRISPR spacer. The identity of the matching spacer, GenBank ID of the sequence and the coordinates of the displayed region are given on the left. The box and grey zone identify the spacer-matching sequence and the consensus sequence, respectively. The middle part of the figure shows a CLUSTAL-generated display of the nucleotide SD for each position of the displayed sequence. The bottom part of the figure shows a summary of the nucleotide frequencies at the positions with high SDs and the deduced consensus sequence. Capital and small letters identify the positions containing >80 % or >60 %, respectively, of one or two bases.

 
Phage resistance of S. thermophilus is correlated with the number of spacers in a CRISPR locus
As many spacers in the CRISPR loci have homology with phage sequences, we searched for a correlation between CRISPR properties and a phage-related phenotype. A previous study reported the phage-resistance profile of a number of S. thermophilus strains (Fayard, 1993Down). The results for a panel of 59 phages tested on a number of strains for which we determined the CRISPR locus sequence are summarized in Table 2Up and displayed in Fig. 6Down. A negative correlation between the number of spacers at a locus and the sensitivity of the strain to phage infection (expressed as a proportion of phages able to propagate on a strain) is observed. About half of the variance of phage sensitivity for nine strains infected by at least one phage can be explained by the number of spacers (R2, 0·51; Fig. 6Down). The five strains resistant to all phages (Fig. 6Down) were not included in the former group, as they may encode dominant, CRISPR-independent, phage-resistant determinants. When the data obtained for additional strains, tested with a smaller panel of seven phages, were examined (Table 1Up; M.-C. Chopin, personal communication) no correlation was seen, possibly due to the small sample size (Fig. 6Down). However, when all the data were pooled, the correlation was still significant (R2, 0·43), suggesting that the small panel results may be not very different from those obtained with the large panel.



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 6. Correlation of S. thermophilus phage resistance and the number of spacers in a CRISPR locus. Filled symbols correspond to data obtained from strains tested with the panel of 59 phages. The line of best-fit refers to strains that were not fully phage resistant ({bullet}), and for which y=–0·02x+0·77 and R2=0·51. Fully phage-resistant strains ({blacksquare}), were not taken into account for the correlation shown. {circ}, Strains tested with the panel of seven phages.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
About 40 % of S. thermophilus CRISPR spacers show significant homology to sequences in the NCBI database. An overwhelming majority of these are homologous to S. thermophilus phages (75 %), and a substantial fraction to S. thermophilus and Lactococcus lactis plasmids (20 %). This indicates the extrachromosomal origin of many CRISPR spacers in S. thermophilus. Are the other spacers in S. thermophilus of a similar origin? At present, the complete sequences of 6 S. thermophilus phages and 6 other lactic acid bacteria phages have been reported (Desiere et al., 2002Down); these 12 constitute possibly the most thoroughly characterized phage group, with respect to genome data (Brussow & Hendrix, 2002Down). In addition, the NCBI database contains partial or complete sequences of over 20 S. thermophilus and 67 Lactococcus lactis plasmids. However, many more S. thermophilus phages and plasmids have still to be sequenced, and it is thus tempting to speculate that many more spacers in this organism have extrachromosomal origin. As these elements must have been invading S. thermophilus strains during their evolutionary history, we suggest that CRISPR spacers reflect past phage and plasmid infections.

An extrachromosomal origin of spacers is not limited to S. thermophilus, as it is found in many other bacteria and archaea. However, some spacers are homologous with genes that are not clearly related to extrachromosomal genes. Remarkably, these genes are frequently (in ~75 % of cases) located in the vicinity of extrachromosomally derived genes, or in regions potentially transferred from unrelated organisms, or in regions where gene order differs from that of the phylogenetically close genomes. Horizontal gene transfer may underlie all these cases, suggesting that incorporation of gene fragments into CRISPR structures might take place upon invasion of a prokaryote cell by foreign DNA. This invasion may be most often mediated by the extrachromosomal elements, but could also be due to other processes, such as DNA transformation. Nevertheless, the overwhelming majority of CRISPR spacers (98 %) have no homology with known genes. The further accumulation of sequences in the databases may reveal the origin of these spacers.

The mechanism of CRISPR generation is not known, but the cas genes, which are invariably closely linked to the CRISPR structures, are presumably involved in this process, as was previously pointed out by Jansen et al. (2002)Down. The process should involve the formation of segments of a defined size, destined to become spacers, and their linkage to the repeated element. The presence of exonuclease motifs of the recB type in the cas4 genes, and the HNH endonuclease motif in the cas5 genes prompts us to suggest that the segments are formed by a nucleolytic activity, but in two different ways. The Cas4 exonuclease might act from an end, as does the RecBCD enzyme complex, aided by a Cas3 helicase, which generates oligonucleotides (Singleton et al., 2004Down and references therein). In contrast, the Cas5 endonuclease might excise the segments by internal DNA cleavage, possibly directed by the short conserved sequence that we identified in the extrachromosomal donor elements at a constant position relative to the spacer-matching region. A precedent for this type of activity is the action of type III restriction enzymes, which cut 25 to 27 bases from their recognition site (see Dryden et al., 2001Down for a review). The type III restriction enzyme-like endonucleolytic action might be polar, as it involves tracking on the DNA, which could account for the biased orientation of the phage-derived spacers in the S. thermophilus CRISPR structures. We envisage that the Cas1 proteins, encoded by the two related genes, cas1A and cas1B, found in the two types of cas gene clusters, may be involved in the process of linking the DNA segments to the repeats. Biochemical study of Cas proteins should allow us to test this model of CRISPR formation.

The biological role of CRISPR elements is not known, although it was suggested that this element plays a role in replicon partitioning (Mojica et al., 1995Down; She et al., 1998Down). A protein that binds to the repeats was purified from Sulfolobus solfataricus, and it was suggested that it might be involved in DNA condensation of the CRISPR structures (Peng et al., 2003Down). Here we report a correlation between the number of spacers in a locus and the resistance of S. thermophilus to phage infection, suggesting that CRISPRs can have a different biological role, protecting the bacteria against phage attack. How could such protection be mediated? A possible mechanism is via anti-sense RNA inhibition of phage gene expression, which is supported by the following observations. First, spacers that are homologous to phage coding sequences can have either of the two orientations within a CRISPR locus, and thus give rise to anti-sense RNA, irrespective of the direction of locus transcription. Second, CRISPR loci do appear to be transcribed, as reported for Archeoglobus fulgidus (Tang et al., 2002Down) and Sulfolobus solfataricus (Tang et al., 2005Down), and can thus generate the anti-sense RNA. It was proposed that various anti-sense short RNAs might regulate gene expression (Tang et al., 2005Down). Third, it was shown that anti-sense RNA inhibits phage propagation (Sturino & Klaenhammer, 2002Down, 2004Down). Studies combining fully sequenced phages and strains with characterized CRISPR loci should allow further testing of this hypothesis, notwithstanding the fact that, besides the effect of CRISPR, many other factors also contribute to phage resistance (see Coffey & Ross, 2002Down for a recent review). Finally, CRISPR spacers could protect bacteria not only against phage infection, but also against invasion by other extrachromosomal elements, inhibiting expression of the genes they carry. Horizontal exchanges between CRISPR elements, which we detected by comparing different loci, could extend the protective range to extrachromosomal elements that have not yet invaded a particular strain. Such a beneficial, protective role could account for the wide spread and the apparent stability of CRISPR structures among prokaryotes.


    ACKNOWLEDGEMENTS
 
We thank Marie-Christine Chopin for communication of unpublished results, Pierre Renault for discussions of the phage-resistance results, and Douwe van Sinderen for providing some of the S. thermophilus strains used in this study.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bolotin, A., Quinquis, B., Renault, P. & 20 other authors (2004). Complete genome sequence and comparative analysis of the dairy bacterium Streptococcus thermophilus. Nat Biotechnol 22, 1554–1558.[CrossRef][Medline]

Brussow, H. & Hendrix, R. W. (2002). Phage genomics, small is beautiful. Cell 108, 13–16.[CrossRef][Medline]

Coffey, A. & Ross, R. P. (2002). Bacteriophage-resistance systems in dairy starter strains, molecular analysis to application. Antonie van Leeuwenhoek 82, 303–321.[CrossRef][Medline]

Desiere, F., Lucchini, S., Canchaya, C., Ventura, M. & Brussow, H. (2002). Comparative genomics of phages and prophages in lactic acid bacteria. Antonie van Leeuwenhoek 82, 73–91.[CrossRef][Medline]

Dryden, D. T., Murray, N. E. & Rao, D. N. (2001). Nucleoside triphosphate-dependent restriction enzymes. Nucleic Acids Res 29, 3728–3741.[Abstract/Free Full Text]

Fayard, B. (1993). Caractérisation de 69 bactériophages of Streptococcus salivarius subsp. thermophilus incluant 10 bactériophages tempérés. PhD thesis, University Nancy I, France.

Groenen, P. M., Bunschoten, A. E., van Soolingen, D. & van Embden, J. D. (1993). Nature of DNA polymorphism in the direct repeat cluster of Mycobacterium tuberculosis, application for strain differentiation by a novel typing method. Mol Microbiol 43, 1057–1065.

Higgins, D. G. & Sharp, P. M. (1989). Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl Biosci 43, 151–153.

Hoe, N., Nakashima, K., Grigsby, D. & 7 other authors (1999). Rapid molecular genetic subtyping of serotype M1 group A Streptococcus strains. Emerg Infect Dis 43, 254–263.

Jansen, R., Embden, J. D. A., van Gaastra, W. & Schouls, L. M. (2002). Identification of genes that are associated with DNA repeats in prokaryotes. Mol Microbiol 43, 1565–1575.[CrossRef][Medline]

Kamerbeek, J., Schouls, L., Kolk, A. & 8 other authors (1997). Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 43, 907–914.

Le Marrec, C., van Sinderen, D., Walsh, L., Stanley, E., Vlegels, E., Moineau, S., Heinze, P., Fitzgerald, G. & Fayard, B. (1997). Two groups of bacteriophages infecting Streptococcus thermophilus can be distinguished on the basis of mode of packaging and genetic determinants for major structural proteins. Appl Environ Microbiol 63, 3246–3253.[Abstract]

Makarova, K. S., Aravind, L., Grishin, N. V., Rogozin, I. B. & Koonin, E. V. (2002). A DNA repair system specific for thermophilic Archaea and bacteria predicted by genomic context analysis. Nucleic Acids Res 30, 482–496.[Abstract/Free Full Text]

Maté, M. J. & Kleanthous, C. (2004). Structure-based analysis of the metal-dependent mechanism of H-N-H endonucleases. J Biol Chem 279, 34763–34769.[Abstract/Free Full Text]

Mojica, F. J., Ferrer, C., Juez, G. & Rodriguez-Valera, F. (1995). Long stretches of short tandem repeats are present in the largest replicons of the Archaea Haloferax mediterranei and Haloferax volcanii and could be involved in replicon partitioning. Mol Microbiol 43, 85–93.

Mojica, F. J., Diez-Villasenor, C., Soria, E. & Juez, G. (2000). Biological significance of a family of regularly spaced repeats in the genomes of Archaea, Bacteria and mitochondria. Mol Microbiol 43, 244–246.[CrossRef]

Peng, X., Brügger, K., Shen, B., Chen, L., She, Q. & Garrett, R. A. (2003). Genus-specific protein binding to the large clusters of DNA repeats (Short Regularly Spaced Repeats) present in Sulfolobus genomes. J Bacteriol 185, 2410–2417.[Abstract/Free Full Text]

Pourcel, C., Salvignol, G. & Vergnaud, G. (2005). CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies. Microbiology 151, 653–663.[Abstract/Free Full Text]

Saravanan, M., Bujnicki, J. M., Cymerman, I. A., Rao, D. N. & Nagaraja, V. (2004). Type II restriction endonuclease R.KpnI is a member of the HNH nuclease superfamily. Nucleic Acids Res 32, 6129–6135.[Abstract/Free Full Text]

Schouls, L. M., Reulen, S., Duim, B., Wagenaar, J. A., Willems, R. J. L., Dingle, K. E., Colles, F. M. & van Embden, J. D. (2003). Comparative genotyping of Campylobacter jejuni by amplified fragment length polymorphism, multilocus sequence typing, and short repeat sequencing: strain diversity, host range, and recombination. J Clin Microbiol 41, 15–26.[Abstract/Free Full Text]

She, Q., Phan, H., Garrett, R. A., Albers, S. V., Stedman, K. M. & Zillig, W. (1998). Genetic profile of pNOB8 from Sulfolobus, the first conjugative plasmid from an archaeon. Extremophiles 2, 417–425.[CrossRef][Medline]

Simpson, C. L., Giffard, P. M. & Jacques, N. A. (1993). A method for the isolation of RNA from Streptococcus salivarius and its application to the transcriptional analysis of the gtfJK locus. FEMS Microbiol Lett 108, 93–97.[Medline]

Singleton, M. R., Dillingham, M. S., Gaudier, M., Kowalczykowski, S. C. & Wigley, D. B. (2004). Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks. Nature 432, 187–193.[CrossRef][Medline]

Stanley, E., Fitzgerald, G. F. & van Sinderen, D. (1999). Characterisation of Streptococcus thermophilus CNRZ1205 and its cured and re-lysogenised derivatives. FEMS Microbiol Lett 176, 503–510.[Medline]

Sturino, J. M. & Klaenhammer, T. R. (2002). Expression of antisense RNA targeted against Streptococcus thermophilus bacteriophages. Appl Environ Microbiol 68, 588–596.[Abstract/Free Full Text]

Sturino, J. M. & Klaenhammer, T. R. (2004). Antisense RNA targeting of primase interferes with bacteriophage replication in Streptococcus thermophilus. Appl Environ Microbiol 70, 1735–1743.[Abstract/Free Full Text]

Tang, T. H., Bachellerie, J. P., Rozhdestvensky, T., Bortolin, M. L., Huber, H., Drungowski, M., Elge, T., Brosius, J. & Huttenhofer, A. (2002). Identification of 86 candidates for small non-messenger RNAs from the archaeon Archaeoglobus fulgidus. Proc Natl Acad Sci U S A 99, 7536–7541.[Abstract/Free Full Text]

Tang, T. H., Polacek, N., Zywicki, M., Huber, H., Brugger, K., Garrett, R., Bachellerie, J. P. & Huettenhofer, A. (2005). Identification of novel non-coding RNAs as potential anti-sense regulators in the archaeon Sulfolobus solfataricus. Mol Microbiol 55, 469–481.[CrossRef][Medline]

Terzaghi, B. E. & Sandine, W. E. (1975). Improved medium for lactic streptococci and their bacteriophages. Appl Microbiol 29, 807–813.

van Belkum, A., Scherer, S., van Alphen, L. & Verbrugh, H. (1998). Short-sequence DNA repeats in prokaryotic genomes. Microbiol Mol Biol Rev 43, 275–293.

Walker, D. C., Georgiou, T., Pommer, A. J., Walker, D., Moore, G. R., Kleanthous, C. & James, R. (2002). Mutagenic scan of the H-N-H motif of colicin E9: implications for the mechanistic enzymology of colicins, homing enzymes & apoptotic endonucleases. Nucleic Acids Res 30, 3225–3234.[Abstract/Free Full Text]

Received 17 March 2005; revised 25 May 2005; accepted 30 May 2005.


This article has been cited by other articles:


Home page
MicrobiologyHome page
J. R. van der Ploeg
Analysis of CRISPR in Streptococcus mutans suggests frequent occurrence of acquired immunity against infection by M102-like bacteriophages
Microbiology, June 1, 2009; 155(6): 1966 - 1976.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
F. J. M. Mojica, C. Diez-Villasenor, J. Garcia-Martinez, and C. Almendros
Short motif sequences determine the targets of the prokaryotic CRISPR defence system
Microbiology, March 1, 2009; 155(3): 733 - 740.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. Carte, R. Wang, H. Li, R. M. Terns, and M. P. Terns
Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes
Genes & Dev., December 15, 2008; 22(24): 3489 - 3496.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
W. M. McShan, J. J. Ferretti, T. Karasawa, A. N. Suvorov, S. Lin, B. Qin, H. Jia, S. Kenton, F. Najar, H. Wu, et al.
Genome Sequence of a Nephritogenic and Highly Transformable M49 Strain of Streptococcus pyogenes
J. Bacteriol., December 1, 2008; 190(23): 7773 - 7785.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
C. Hale, K. Kleppe, R. M. Terns, and M. P. Terns
Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus
RNA, December 1, 2008; 14(12): 2572 - 2579.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
S. J. J. Brouns, M. M. Jore, M. Lundgren, E. R. Westra, R. J. H. Slijkhuis, A. P. L. Snijders, M. J. Dickman, K. S. Makarova, E. V. Koonin, and J. van der Oost
Small CRISPR RNAs Guide Antiviral Defense in Prokaryotes
Science, August 15, 2008; 321(5891): 960 - 964.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Beloglazova, G. Brown, M. D. Zimmerman, M. Proudfoot, K. S. Makarova, M. Kudritska, S. Kochinyan, S. Wang, M. Chruszcz, W. Minor, et al.
A Novel Family of Sequence-specific Endoribonucleases Associated with the Clustered Regularly Interspaced Short Palindromic Repeats
J. Biol. Chem., July 18, 2008; 283(29): 20361 - 20371.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. F. Andersson and J. F. Banfield
Virus Population Dynamics and Acquired Virus Resistance in Natural Microbial Communities
Science, May 23, 2008; 320(5879): 1047 - 1050.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
E. Pelletier, A. Kreimeyer, S. Bocs, Z. Rouy, G. Gyapay, R. Chouari, D. Riviere, A. Ganesan, P. Daegelen, A. Sghir, et al.
"Candidatus Cloacamonas Acidaminovorans": Genome Sequence Reconstruction Provides a First Glimpse of a New Bacterial Division
J. Bacteriol., April 1, 2008; 190(7): 2572 - 2579.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
H. Deveau, R. Barrangou, J. E. Garneau, J. Labonte, C. Fremaux, P. Boyaval, D. A. Romero, P. Horvath, and S. Moineau
Phage Response to CRISPR-Encoded Resistance in Streptococcus thermophilus
J. Bacteriol., February 15, 2008; 190(4): 1390 - 1400.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
P. Horvath, D. A. Romero, A.-C. Coute-Monvoisin, M. Richards, H. Deveau, S. Moineau, P. Boyaval, C. Fremaux, and R. Barrangou
Diversity, Activity, and Evolution of CRISPR Loci in Streptococcus thermophilus
J. Bacteriol., February 15, 2008; 190(4): 1401 - 1412.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
L. Diancourt, V. Passet, C. Chervaux, P. Garault, T. Smokvina, and S. Brisse
Multilocus Sequence Typing of Lactobacillus casei Reveals a Clonal Population Structure with Low Levels of Homologous Recombination
Appl. Envir. Microbiol., October 15, 2007; 73(20): 6601 - 6611.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. Grissa, G. Vergnaud, and C. Pourcel
CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats
Nucleic Acids Res., July 13, 2007; 35(suppl_2): W52 - W57.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
R. Barrangou, C. Fremaux, H. Deveau, M. Richards, P. Boyaval, S. Moineau, D. A. Romero, and P. Horvath
CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes
Science, March 23, 2007; 315(5819): 1709 - 1712.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
K. S. Makarova and E. V. Koonin
Evolutionary Genomics of Lactic Acid Bacteria
J. Bacteriol., February 15, 2007; 189(4): 1199 - 1208.
[Full Text] [PDF]


Home page
MicrobiologyHome page
G. Erauso, K. M. Stedman, H. J. G. van de Werken, W. Zillig, and J. van der Oost
Two novel conjugative plasmids from a single strain of Sulfolobus
Microbiology, July 1, 2006; 152(7): 1951 - 1968.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. van de Guchte, S. Penaud, C. Grimaldi, V. Barbe, K. Bryson, P. Nicolas, C. Robert, S. Oztas, S. Mangenot, A. Couloux, et al.
The complete genome sequence of Lactobacillus bulgaricus reveals extensive and ongoing reductive evolution
PNAS, June 13, 2006; 103(24): 9274 - 9279.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
R. T. DeBoy, E. F. Mongodin, J. B. Emerson, and K. E. Nelson
Chromosome Evolution in the Thermotogales: Large-Scale Inversions and Strain Diversification of CRISPR Sequences.
J. Bacteriol., April 1, 2006; 188(7): 2364 - 2374.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Tables
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bolotin, A.
Right arrow Articles by Ehrlich, S. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bolotin, A.
Right arrow Articles by Ehrlich, S. D.
Agricola
Right arrow Articles by Bolotin, A.
Right arrow Articles by Ehrlich, S. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2005 Society for General Microbiology.