| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Bioquímica de l'Estrès Oxidatiu, Departament de Ciències Mèdiques Bàsiques, IRBLleida, Universitat de Lleida, 25008 Lleida, Spain
Correspondence
Joaquim Ros
joaquim.ros{at}cmb.udl.es
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
), while strong oxidation can promote protein aggregation, making proteins unavailable for proteasome degradation (Grune et al., 2004). The accumulation of these modified proteins in a cell contributes to the ageing phenotype (Harman, 1981; Stadtman, 1992; Stadtman & Levine, 2000; Levine, 2002; Nyström, 2005). In yeasts, replicative ageing refers to the number of cell divisions occurring in a mother yeast cell (Sinclair, 2002). Chronological ageing refers to the ability of cells to maintain viability in stationary phase (Herman, 2002).
During the last decade investigations of ageing have uncovered physiological and molecular mechanisms involved in this process, as well as providing some clues towards understanding life-span lengthening (Bordone & Guarente, 2005). Calorie restriction is one of the mechanisms that has been consistently proven to extend life span in organisms ranging from yeasts to mammals (Sohal & Weindruch, 1996). In yeast, the replicative life span can be increased by shifting the cells from 2 to 0.5 % glucose (calorie restriction) (Lin et al., 2002, 2004). One of the key molecules is the silent information regulator 2 (Sir2)p, a class III NAD+-dependent histone deacetylase, which is involved in several physiologically important functions such as silencing telomeres and rDNA, maintaining genome integrity, and ageing (Bitterman et al., 2003). Strains that have an extra copy of the SIR2 gene have a life span extended by 40 %, while deletion of SIR2 shortens life span by 50 % (Kaeberlein et al., 1999). Under calorie restriction, the oxygen consumption increases, thus raising the NAD+/NADH ratio by lowering the concentration of NADH. Since NADH has been described as a Sir2p inhibitor, calorie restriction results in higher Sir2p activity (Lin et al., 2002; Lin & Guarente, 2003), contributing to life-span extension. Nevertheless, the importance of this ratio to the activation of Sir2p has been questioned (Anderson et al., 2003; Kaeberlein et al., 2004; Grubisha et al., 2005).
Chronological ageing in yeast has been used as a valuable model to study oxidative damage and ageing of the post-mitotic tissues of higher organisms (Sinclair, 2002; MacLean et al., 2001). In post-diauxic cultures, respiration is the main source of energy for the yeast cell. It is obtained from previously stored nutrients such as glycogen and trehalose. The cell wall thickens and cells become more resistant to heat and oxidative stresses. Chronological life-span extension is highly dependent on stress resistance (Fabrizio et al., 2001) and has been observed under calorie restriction (Fabrizio et al., 2004; Reverter-Branchat et al., 2004) and in cells overexpressing superoxide dismutase (Sod)2p (Harris et al., 2003).
Replicative and chronological ageing show markers of oxidative stress and selective oxidative modification of proteins. These major protein targets have been identified as enzymes of glucose and energy metabolism, as well as stress resistance and cytoskeletal proteins (Reverter-Branchat et al., 2004). Such oxidative damage to proteins and other stress markers are reduced in cells cultured under calorie restriction.
In this context, one could ask whether the impairment of a given protein function caused by such modifications (i) actively contributes to the ageing phenotype, (ii) is merely a consequence of the ageing process or (iii) has been evolutionarily favoured (e.g. impairment of glycolytic flux to favour the pentose phosphate pathway under stress conditions). Whichever is the case, one might think that the preservation of cell viability would be the main goal. With the aim of getting an insight into question (i) above, we prepared strains that overproduced one of these target proteins and analysed the impact of this extra dose on life span. In other words, is the additional activity of a particular protein advantageous or detrimental to cell life span?
We have previously reported that one of the oxidatively modified targets is alcohol dehydrogenase 1 (Adh1)p (Reverter-Branchat et al., 2004). This enzyme is involved in glucose metabolism in S. cerevisiae, and catalyses the conversion of acetaldehyde to ethanol by a concomitant conversion of NADH into NAD+, thus contributing to balancing the levels of the oxidized cofactor. As a consequence of decreased enzymic activity, the steady state of NAD+/NADH levels would vary. Such variation would affect the activity of Sir2p, thus affecting life span. For these reasons we focused our investigation on cells possessing an extra copy of the dehydrogenase gene. The results presented in this paper provide evidence that this strain shows extended replicative and chronological life span. Responses to mild endogenous oxidative stress in combination with an increased activity of Sir2p are the main traits responsible for the life-span lengthening observed.
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
. S. cerevisiae CML128 (MATa ura3-52 his4 leu2-3,112 trp1) was used as a parental wild-type (WT) strain (Gallego et al., 1997). The strain GRB2402 carried a second copy of the ADH1 gene in the genome. This strain was constructed by integrating plasmid pTB106 in the chromosome at the LEU2 locus after ClaI-mediated linearization of the plasmid. Plasmid pTB106 was constructed as follows. The ADH1 gene product was obtained using the oligonucleotides ADH1F (GACACCCGGGTTCAATTCATTTGGGTGTGC) and ADH1R (GACAGAATTCCTGAAGGCTAGGCTGTGGA), and was subsequently cloned into the EcoRI and SmaI sites of the Yiplac128 vector. The strain GRB2401 was obtained by integrating the empty Yiplac128 vector in CML128. Deletion of the SIR2 gene was obtained by replacing the ORF with a kanMX cassette system using p43965, a pUG26-derived vector (from the Euroscarf collection), digested with NotI. Strains GRB2401UT and GRB2402UT were constructed by transformation with plasmid pADH4UCA-IV (a kind gift of D. Gottschling, Fred Hutchinson Cancer Research Center) in GRB2401 and GRB2402 backgrounds, respectively. Plasmid pADH4UCA-IV, containing the URA3 reporter gene, was digested wtih SalI and EcoRI prior to transformation, and was integrated into the subtelomeric region of chromosome VII as described elsewhere (Gottschling et al., 1990).
|
).
Western blot analysis.
Cell extracts were obtained as described by Rodriguez-Manzaneque et al. (1999), separated in SDS-polyacrylamide gels and transferred to PVDF membranes. The following antibodies were used: anti-Adh (1 : 400 000 dilution; Chemicon), anti-aconitase (1 : 2000 dilution; a gift from R. Lill, Philipps-Universität Marburg), anti-
-ketoglutarate dehydrogenase [1 : 5000 dilution; raised in rabbit as described by Cabiscol et al. (2002)], anti-mitochondrial porin (1 : 1000 dilution; Molecular Probes), anti-Ssa (1 : 600 dilution; EAC), anti-Ssb (1 : 600 dilution; EAC), anti-Hsp104 (1 : 5000 dilution; StressGen), anti-Hsc90 (1 : 10 000 dilution; a gift of S. Lindquist, Whitehead Institute of Biomedical Research), and anti-Hsp60 (1 : 8000 dilution; StressGen). Secondary antibodies conjugated to horseradish peroxidase were used as follows: goat anti-mouse antibody (1 : 2500 dilution; Pierce), donkey anti-rabbit antibody (1 : 12 500 dilution; Amersham) and rabbit anti-goat antibody (1 : 25 000 dilution; Pierce).
Enzyme activities.
Cell extracts were obtained using glass beads. Catalase activity was measured as described by Jakubowski et al. (2000). Sod (Sod1 and Sod2) and Adh activities were assayed by chromogenic staining (zymogram), as described in Luk & Culotta (2001) (Sod) and Williamson et al. (1980) (Adh).
Life-span determination.
To measure chronological life span, exponential-phase cells (2x107 cells ml–1) incubated in YPD medium were regarded as day 0. To determine the age-dependent mortality, cell viability at different days of growth was compared by spreading serial dilutions (1 : 10) of the cultures on solid YPD plates followed by incubation at 30 °C for 3 days. Replicative life-span determinations were performed by micromanipulation, as described elsewhere (Smith & Boeke, 1997; Sinclair & Guarente, 1997), using a Singer MSM system 300 micromanipulator. Life-span analyses wer carried out on YPD plates twice independently with 60 cells per strain per experiment. Cells that never budded were excluded from analysis.
Silencing assay.
Telomeric URA3 reporter strains GRB2401UT (WT-UT) and GRB2402UT (2xADH1-UT) were assayed for Sir2p-silencing activity. Cells were grown at 30 °C in SC medium plus uracil (20 µg ml–1) to 2x107 cells ml–1. Cells were centrifuged, washed and diluted 1 : 10 in SC medium lacking uracil, with or without the Sir2p inhibitors splitomicin (5 µM) or nicotinamide (NAM; 1 mM). Growth was measured and the duplication time calculated after a 1 h adaptation period.
Analysis.
Ethanol concentration was analysed enzymically in cell-free culture media obtained at different times of growth, from exponential to diauxic phase (2 days) using the Ethanol UV test (Roche Diagnostics). Resistance to H2O2 or heat shock was tested on cells grown on YPD or YPG media. At the middle of exponential phase (2x107 cells ml–1), cells were either changed to 48 °C and incubated for 10, 20 and 30 min, or treated with H2O2 for 60 min at the required concentration. Viability was measured by plating 0.1 and 0.2 ml of culture dilution on YPD plates and counting survivor colonies after 2 days at 30 °C. Levels of NAD+ and NADH were measured as described by Ashrafi et al. (2000). Total cellular iron was determined under reducing conditions with bathophenanthroline sulfonate as chelator (Tamarit et al., 2006). Superoxide ion levels were measured in a spectrofluorophotometer (RF-5000, Shimadzu). Exponentially growing cells were washed in water and resuspended in PBS plus 0.1 % (v/v) glycerol and the superoxide-specific probe dihydroethidium (DHE; 5 µg ml–1) (Fluka) (Aguilaniu et al., 2003). The rate of oxidation of DHE was calculated from the rate of increase in fluorescence for 30 min (excitation 520 nm, emission 590 nm). Oxygen consumption was measured in a Clark detector, as described by Brown & Cooper (1995). In brief, oxygen uptake was measured in a 4 ml stirred chamber (100 r.p.m.) using a YSI 53 biological oxygen monitor (Yellow Springs Instruments) following the manufacturer's directions. A volume containing 1x107 cells grown in YPD was harvested at mid-exponential phase, washed, resuspended in fresh YPD medium and tested for oxygen consumption. Results shown represent the mean±SEM of three experimental trials.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
), our group has demonstrated that several glycolytic enzymes (Adh1p, enolase, glyceraldehyde-3-phosphate dehydrogenase, pyruvate decarboxylase and fructose-1,6-bisphosphate aldolase) are oxidatively damaged during yeast ageing (both chronological and replicative). In order to investigate the effect of an increased amount of a given protein in the ageing process and stress resistance, we constructed a strain carrying an extra copy of the ADH1 gene. When cells with an extra copy of ADH1 were cultured in YPD media they effectively expressed 70 % more Adh1p (Fig. 1a) and, accordingly, the activity was increased by 60 % (Fig. 1b) compared to the WT strain carrying the empty plasmid. The introduction of the extra copy did not affect the duplication time, which was 90 min in both strains.
|
). The viability of the WT and 2xADH1 strains was monitored for 70 days. As shown in Fig. 1(c)
, survival declined after day 30 for WT cells, while such a decline was not observed until day 40 for the 2xADH1 strain.
In order to explain the extended viability in stationary phase, resistance to oxidative stress was analysed in both strains. WT and 2xADH1 cells were grown exponentially in YPD, challenged with several H2O2 concentrations for 1 h, and viability assays were performed. Fig. 1(d) indicates that the 2xADH1 strain was clearly more resistant than WT. The increased resistance to oxidative stress observed during exponential phase by the 2xADH1 cells extended into stationary phase, since cells from 25 days of culture showed higher resistance to H2O2 than WT cells (data not shown). Additionally, cell survival after heat stress (48 °C) was also increased in the 2xADH1 strain (Fig. 1e).
Growth on a respiratory carbon source such as glycerol (YPG medium) can be used as an internal control, since the activity of Adh1p as a fermentative enzyme is dispensable. When both strains were grown exponentially in YPG, no differences were observed when the cultures were challenged with H2O2, indicating that the different phenotype was due to the increased Adh activity (data not shown).
Antioxidant enzymes are induced in 2xADH1 cells
We next measured the level of enzymes mainly involved in oxidative stress resistance (Fig. 2a). Catalase activity was 40 % higher in 2xADH1 cells compared to WT when grown in YPD. Sod1 (cytosolic, Cu/Zn-dependent) and Sod2 (mitochondrial, Mn-dependent) activities measured in these strains were also 30 and 50 % higher, respectively. These results could explain the increased resistance to both oxidative and heat stresses, since there is a well-known cross-protection effect mediated by several stress transcription factors (Martinez-Pastor et al., 1996; Schmitt & McEntee, 1996). The increased catalase activity observed in the 2xADH1 cells when grown exponentially was also observed at stationary phase, since cells from 3 to 25 days of culture showed higher catalase activity (
30 % more) compared to WT cells (data not shown).
|
, the rate of oxidation of DHE, a superoxide-specific probe, was increased fourfold in 2xADH1 cells. Such differences were abrogated when cells were grown in YPG media (data not shown).
The fact that the catalytic activity of Adh1p generates ethanol opened the possibility that these cells carrying an extra copy of ADH1 were under ethanol stress (Piper, 1995). In this context, it has been reported that translocation of Msn2 to the nucleus upon environmental ethanol stress triggers the expression of resistance genes (van Voorst et al., 2006). As shown in Fig. 3(a), the ethanol concentration present in the culture media from exponential to diauxic phase was the same in both strains. In addition, quantification by Western blotting of several heat-shock proteins, known to be induced during ethanol stress (Piper, 1995), showed no difference (Fig. 3b).
|
, a 25 % increase in oxygen consumption was observed in 2xADH1 compared to the WT strain.
|
-ketoglutarate dehydrogenase and the mitochondrial outer-membrane porin when compared with the amounts present in WT cells (Fig. 4b). These results ruled out the possibility that an increased number of mitochondria was responsible for increased oxygen consumption.
Strains carrying an extra ADH1 copy show extended replicative life span and increased Sir2p activity
Replicative life span has been defined as the number of buds generated by a dividing individual mother. The increased activity of Adh1p in 2xADH1 cells would vary the NAD+/NADH ratio. This ratio has been demonstrated to have effects on Sir2 activity and, consequently, on replicative life span. The mean and maximum life span can be quantified by micromanipulation experiments. As shown in Fig. 5(a), mean life span increased 30 % in the 2xADH1 cells compared to WT (20 generations for WT and 26 for 2xADH1 cells).
|
, the NAD+/NADH ratio in the 2xADH1 strain was increased by 20 % compared to that of WT cells grown in YPD. Consistently, cells grown in YPG showed a twofold increase in the NAD+/NADH ratio with respect to YPD-grown cells, but no differences were observed between the two strains (data not shown). To analyse whether a 20 % increase in NAD+/NADH ratio could affect Sir2 activity, we constructed the strains GRB2401UT (WT-UT) and GRB2402UT (2xADH1-UT). They had the URA3 reporter gene integrated into the subtelomeric region of chromosome VII-L, thus allowing for efficient determination of Sir2-dependent telomeric silencing (Aparicio & Gottschling, 1994). Because Ura3p is required for uracil biosynthesis, the more silenced the telomeric URA3 gene (higher Sir2 activity) the slower the growth in medium lacking uracil. Fig. 5(c) shows that the duplication times of WT-UT and 2xADH1-UT grown on SC medium were 196 and 238 min, respectively. To demonstrate that this difference in duplication time was Sir2p-dependent, the addition of two well-known Sir2p inhibitors, splitomicin (Bedalov et al., 2001) and NAM (Bitterman et al., 2002; Jackson et al., 2003) was used. Derepression of the URA3 reporter should result in growth enhancement on medium lacking uracil. Addition of 5 µM splitomicin or 1 mM NAM to the medium abrogated the differences in duplication time observed between WT-UT and 2xADH1-UT. With these treatments, cells grew almost as fast as in synthetic medium plus uracil; no differences were observed between the two strains (duplication times of 120 and 122 min, respectively) (Fig. 5c).
Sir2-mediated oxidative-stress resistance
Could Sir2p mediate the resistance to oxidative stress observed in 2xADH1 cells? In fact, mammalian cells respond to oxidative stress by the formation of complexes between Sirt1p, the orthologue of Sir2p, and members of forkhead transcription factors (FOXOs) (Brunet et al., 2004; Kobayashi et al., 2005). Such interaction allows these factors to control various biological functions, including detoxification of ROS (Kops et al., 2002). To answer the above question, the SIR2 gene was deleted in the WT and 2xADH1 background cells to obtain the corresponding sir2
derivatives. Fig. 6(a, b) shows that GRB2403 (WT sir2) and GRB2404 (2xADH1 sir2) displayed the same resistance to both oxidative and heat stresses. Accordingly, when catalase activity was measured in these strains grown at exponential phase, no significant difference was observed (Fig. 6c). Additionally, catalase activity in both strains showed no significant difference in stationary phase (data not shown). These results indicated that the increased antioxidant capacity (and consequently higher survival in stationary phase) was a SIR2-dependent process in 2xADH1 cells.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
60 % more activity. Initial results showed that this strain was resistant to both oxidative and heat stresses by moderate increases in catalase, Sod1p and Sod2p. In contrast, strains carrying an extra copy of one of the genes coding for proteins that are also targets of oxidative stress, such as enolase, pyruvate decarboxylase and fructose-1,6-bisphosphate aldolase (Reverter-Branchat et al., 2004), did not display such a phenotype (data not shown).
Chronological life-span extension has been related to antioxidant activity in stationary phase (Fabrizio et al., 2001; Fabrizio & Longo, 2003). Given the characteristics described for 2xADH1 cells, survival on stationary phase could be a consequence of such resistance. The data presented here on stress resistance show that cells adapted to increased respiratory conditions are more stress resistant in both exponential and stationary phase, and show extended chronological life span (MacLean et al., 2001). It has also been reported that SOD2 overexpression (10-fold normal levels) increases yeast chronological life span (Harris et al., 2003), although replicative life span is shortened due to defects in mitochondrial segregation. Such life-span reduction is independent of Sir2p. In our model, these problems were not observed, probably because in 2xADH1 cells only a mild increase in Sod1p and Sod2p was observed. In addition, these cells induced not only Sod2p but a balanced set of antioxidant enzymes.
The data for DHE oxidation also indicated the existence of an endogenous oxidative stress in 2xADH1 cells. Iron, as a prooxidant metal, was also measured as a possible inducer of oxidative stress. Total iron values measured in cultures of WT and 2xADH1 cells grown in YPD at exponential phase as well as during stationary phase were indistinguishable (data not shown). How can the increased Adh1 activity generate such a mild stress situation? An ethanol stress was ruled out by experimental data (Fig. 3a, b). One possible explanation relies on the existence of the ethanol/acetaldehyde shuttle (Lin & Guarente, 2003; Bakker et al., 2001). According to this pathway, some of the ethanol produced by glycolysis diffuses across the mitochondrial membrane. In the matrix, mitochondrial dehydrogenases oxidize ethanol, with a concomitant conversion of NAD+ to NADH, which, in turn, is then oxidized to NAD+ by the electron transport chain. Increased Adh1 activity would therefore raise the activity of this shuttle and, as a result, a rise in oxygen consumption in these cells should be observed (Fig. 4a) as well as increased ROS production (as detected by DHE oxidation). Another possibility to explain the observed phenotype (increased oxygen consumption, oxidant resistance, and chronological and replicative life span) is that 2xADH1 cells have lowered catabolite repression. A similar situation is observed under calorie restriction when yeast is switched from 2 to 0.5 % glucose, generating increased respiration and therefore an increased NAD+/NADH ratio (Lin et al., 2002).
In any case, the fact that replicative life span was increased in the 2xADH1 cells seems, a priori, to be a consequence of the increased NAD+/NADH ratio. It is worth pointing out that replicative life span increased 30 %, a value quite similar to that reported for cells grown under calorie restriction (Lin et al., 2002). However, since the increase in NAD+/NADH ratio observed in cells with an extra copy of ADH1 was moderate, testing Sir2 activity seemed relevant to support the results obtained. This was carried out by measuring silencing in cells in which the URA3 reporter gene was located in the telomere, under Sir2p regulation. Duplication time was 20 % slower in the 2xADH1 strain, and this difference was abolished when splitomicin or NAM was added to the culture. The specificity of these inhibitors indicated that the difference was due to higher Sir2p activity.
The results obtained from the sir2 strains (WT sir2 and 2xADH1 sir2) indicate that the response to mild oxidative stress is mediated by Sir2p. In contrast to the differences observed between WT and 2xADH1 cells, the derivative strains lacking SIR2 showed the same catalase activity and, accordingly, the same survival after H2O2 treatment. How can SIR2 be involved in a response to the mild oxidative stress observed in the 2xADH1 strain? In S. cerevisiae, adaptation to H2O2 correlates with the rapid induction of a so-called H2O2 stimulon of several hundred proteins (Godon et al., 1998) and the repression of many others. This adaptation is orchestrated by the action of several transcriptional regulators, such as Msn2/Msn4 (Hasan et al., 2002), Yap1 and Skn7 (Kuge & Jones, 1994; Krems et al., 1996). To our knowledge, there are no reports connecting Sir2p with the activation of such transcription factors in yeast. However, in mammalian cells, Sirt1p, the mammalian orthologue of Sir2p, interacts with and deacetylates FOXOs (Brunet et al., 2004; Van der Horst et al., 2004). These factors enter the nucleus under stress conditions. As a consequence, they transactivate a series of target genes that have critical roles in the cellular response to ROS detoxification by inducing Sod1p and Sod2p, and catalase (Kops et al., 2002; Nemoto & Finkel, 2002; Giannakou & Partridge, 2004). Since the S. cerevisiae genome has four FOXOs (FKH1, FKH2, FHL1 and HCM1), it could be that the increased amount of Sir2p observed enhances the deacetylation of such forkheads. As a result, activation of genes having critical roles in ROS detoxification, such as catalase and Sods, could occur. This possibility needs to be explored. However, because 2xADH1 cells present a change in redox state, the role of Yap1, which is regulated through thiol oxidation/reduction (Delaunay et al., 2000), also merits future experimental work.
Our results concerning increased replicative and chronological life span seem to be in contradiction with observations reported by V. D. Longo and colleagues (Fabrizio et al., 2005). They showed that deletion of SIR2 increases stress resistance and concluded that the effects of SIR2 on chronological life span are opposite to those on replicative life span. One of the consequences of SIR2 deletion, among others, is a substantial increase in mutation frequency. Such problems may activate a pathway of oxidative-stress resistance, and this is clear by a comparison of the gene-expression profiles between sir2 and WT cells (Fabrizio et al., 2005). In fact, our observations in the WT sir2 strain also confirm a moderately higher stress resistance, at exponential phase, compared to the original WT strain. However, this does not necessarily mean that SIR2 reduces stress resistance. In fact, 2xSIR2 cells have been described as more resistant when submitted to heat shock (Anderson et al., 2002). Probably, the increased stress resistance observed in both sir2 and 2xSIR2 cells is a consequence of the activation of different pathways.
Regarding the question about the relationship between oxidative modification and ageing, it seems clear that oxidative damage of Adh1p contributes to the ageing phenotype. The relevance of maintaining Adh1p activity is to maintain the NAD+/NADH ratio, which in turn contributes to the maintenance of Sir2 activity. Although the results shown in this paper have been obtained with an overdose of ADH1, of which the only known function is to participate in the fermentative metabolism of glucose, it is not purely speculative to infer from these results that the impairment of any enzyme that participates in NAD+/NADH balancing will actively affect cell ageing.
|
ACKNOWLEDGEMENTS |
|---|
Edited by: M. Molina
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Anderson, R. M., Bitterman, K. J., Wood, J. G., Medvedik, O., Cohen, H., Lin, S. S., Manchester, J. K., Gordon, J. I. & Sinclair, D. A. (2002). Manipulation of a nuclear NAD+ salvage pathway delays aging without altering steady-state NAD+ levels. J Biol Chem 277, 18881–18890.
Anderson, R. M., Latorre-Esteves, M., Neves, A. R., Lavu, S., Medvedik, O., Taylor, C., Howitz, K. T., Santos, H. & Sinclair, D. A. (2003). Yeast life-span extension by calorie restriction is independent of NAD fluctuation. Science 302, 2124–2126.
Aparicio, O. M. & Gottschling, D. E. (1994). Overcoming telomeric silencing: a trans-activator competes to establish gene expression in a cell cycle-dependent way. Genes Dev 8, 1133–1146.
Ashrafi, K., Lin, S. S., Manchester, J. K. & Gordon, J. I. (2000). Sip2p and its partner snf1p kinase affect aging in S. cerevisiae. Genes Dev 14, 1872–1885.
Bakker, B. M., Overkamp, K. M., van Maris, A. J. A., Kotter, P., Luttik, M. A. H., van Dijken, J. P. & Pronk, J. T. (2001). Stoichiometry and compartmentation of NADH metabolism in Saccharomyces cerevisiae. FEMS Microbiol Rev 25, 15–37.[CrossRef][Medline]
Bedalov, A., Gatbonton, T., Irvine, W. P., Gottschling, D. E. & Simon, J. A. (2001). Identification of a small molecule inhibitor of Sir2p. Proc Natl Acad Sci U S A 98, 15113–15118.
Bitterman, K. J., Anderson, R. M., Cohen, H. Y., Latorre-Esteves, M. & Sinclair, D. A. (2002). Inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of yeast sir2 and human SIRT1. J Biol Chem 277, 45099–45107.
Bitterman, K. J., Medvedik, O. & Sinclair, D. A. (2003). Longevity regulation in Saccharomyces cerevisiae: linking metabolism, genome stability, and heterochromatin. Microbiol Mol Biol Rev 67, 376–399.
Bordone, L. & Guarente, L. (2005). Calorie restriction, SIRT1 and metabolism: understanding longevity. Nat Rev Mol Cell Biol 6, 298–305.[CrossRef][Medline]
Brown, G. C. & Cooper, C. E. (editors) (1995). Bioenergetics, a Practical Approach. Oxford: IRL Press.
Brunet, A., Sweeney, L. B., Sturgill, J. F., Chua, K. F., Greer, P. L., Lin, Y., Tran, H., Ross, S. E., Mostoslavsky, R. & other authors (2004). Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 303, 2011–2015.
Cabiscol, E., Belli, G., Tamarit, J., Echave, P., Herrero, E. & Ros, J. (2002). Mitochondrial Hsp60, resistance to oxidative stress, and the labile iron pool are closely connected in Saccharomyces cerevisiae. J Biol Chem 277, 44531–44538.
Delaunay, A., Isnard, A. D. & Toledano, M. B. (2000). H2O2 sensing through oxidation of the Yap1 transcription factor. EMBO J 19, 5157–5166.[CrossRef][Medline]
Fabrizio, P. & Longo, V. D. (2003). The chronological life span of Saccharomyces cerevisiae. Aging Cell 2, 73–81.[CrossRef][Medline]
Fabrizio, P., Pozza, F., Pletcher, S. D., Gendron, C. M. & Longo, V. D. (2001). Regulation of longevity and stress resistance by Sch9 in yeast. Science 292, 288–290.
Fabrizio, P., Battistella, L., Vardavas, R., Gattazzo, C., Liou, L. L., Diaspro, A., Dossen, J. W., Gralla, E. B. & Longo, V. D. (2004). Superoxide is a mediator of an altruistic aging program in Saccharomyces cerevisiae. J Cell Biol 166, 1055–1067.
Fabrizio, P., Gattazzo, C., Battistella, L., Wei, M., Cheng, C., McGrew, K. & Longo, V. D. (2005). Sir2 blocks extreme life-span extension. Cell 123, 655–667.[CrossRef][Medline]
Gallego, C., Garí, E., Colomina, N., Herrero, E. & Aldea, M. (1997). The Cln3 cyclin is down regulated by transcriptional repression and regulation during the G1 arrest caused by nitrogen deprivation in budding yeast. EMBO J 16, 7196–7206.[CrossRef][Medline]
Giannakou, M. E. & Partridge, L. (2004). The interaction between FOXO and SIRT1: tipping the balance towards survival. Trends Cell Biol 14, 408–412.[CrossRef][Medline]
Godon, C., Lagniel, G., Lee, J., Buhler, J. M., Kieffer, S., Perrot, M., Boucherie, H., Toledano, M. B. & Labarre, J. (1998). The H2O2 stimulon in Saccharomyces cerevisiae. J Biol Chem 273, 22480–22489.
Gottschling, D. E., Aparicio, O. M., Billington, B. L. & Zakian, V. A. (1990). Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63, 751–762.[CrossRef][Medline]
Grubisha, O., Smith, B. C. & Denu, J. M. (2005). Small molecule regulation of Sir2 protein deacetylases. FEBS J 272, 4607–4616.[CrossRef][Medline]
Grune, T., Jung, T., Merker, K. & Davies, K. J. (2004). Decreased proteolysis caused by protein aggregates, inclusion bodies, plaques, lipofuscin, ceroid, and ‘aggresomes’ during oxidative stress, aging, and disease. Int J Biochem Cell Biol 36, 2519–2530.[CrossRef][Medline]
Harman, D. (1981). The aging process. Proc Natl Acad Sci U S A 78, 7124–7128.
Harris, N., Costa, V., MacLean, M., Mollapour, M., Moradas-Ferreira, P. & Piper, P. W. (2003). Mnsod overexpression extends the yeast chronological (G0) life span but acts independently of Sir2p histone deacetylase to shorten the replicative life span of dividing cells. Free Radic Biol Med 34, 1599–1606.[CrossRef][Medline]
Harris, N., Bachler, M., Costa, V., Mollapour, M., Moradas-Ferreira, P. & Piper, P. W. (2005). Overexpressed Sod1p acts either to reduce or to increase the lifespans and stress resistance of yeast, depending on whether it is Cu2+-deficient or an active Cu,Zn-superoxide dismutase. Aging Cell 4, 41–52.[CrossRef][Medline]
Hasan, R., Leroy, C., Isnard, A. D., Labarre, J., Boy-Marcotte, E. & Toledano, M. B. (2002). The control of the yeast H2O2 response by the Msn2/4 transcription factors. Mol Microbiol 45, 233–241.[CrossRef][Medline]
Herman, P. K. (2002). Stationary phase in yeast. Curr Opin Microbiol 5, 602–607.[CrossRef][Medline]
Jackson, M. D., Schmidt, M. T., Oppenheimer, N. J. & Denu, J. M. (2003). Mechanism of nicotinamide inhibition and transglycosidation by Sir2 histone/protein deacetylases. J Biol Chem 278, 50985–50998.
Jakubowski, W., Bilinski, T. & Bartosz, G. (2000). Oxidative stress during aging of stationary cultures of the yeast Saccharomyces cerevisiae. Free Radic Biol Med 28, 659–664.[CrossRef][Medline]
Kaeberlein, M., McVey, M. & Guarente, L. (1999). The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev 13, 2570–2580.
Kaeberlein, M., Kirkland, K. T., Fields, S. & Kennedy, B. K. (2004). Sir2-independent life span extension by calorie restriction in yeast. PLoS Biol 2, E296[CrossRef][Medline]
Kaiser, C., Michaelis, S. & Michell, A. (editors) (1994). Methods in Yeast Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Kobayashi, Y., Furukawa-Hibi, Y., Chen, C., Horio, Y., Isobe, K., Ikeda, K. & Motoyama, N. (2005). SIRT1 is critical regulator of FOXO-mediated transcription in response to oxidative stress. Int J Mol Med 16, 237–243.[Medline]
Kops, G. J., Dansen, T. B., Polderman, P. E., Saarloos, I., Wirtz, K. W., Coffer, P. J., Huang, T. T., Bos, J. L., Medema, R. H. & Burgering, B. M. (2002). Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature 419, 316–321.[CrossRef][Medline]
Krems, B., Charizanis, C. & Entian, K. D. (1996). The response regulator-like protein Pos9/Skn7 of Saccharomyces cerevisiae is involved in oxidative stress resistance. Curr Genet 29, 327–334.[Medline]
Kuge, S. & Jones, N. (1994). YAP1 dependent activation of TRX2 is essential for the response of Saccharomyces cerevisiae to oxidative stress by hydroperoxides. EMBO J 13, 655–664.[Medline]
Levine, R. L. (2002). Carbonyl modified proteins in cellular regulation, aging, and disease. Free Radic Biol Med 32, 790–796.[CrossRef][Medline]
Lin, S. J. & Guarente, L. (2003). Nicotinamide adenine dinucleotide, a metabolic regulator of transcription, longevity and disease. Curr Opin Cell Biol 15, 241–246.[CrossRef][Medline]
Lin, S. J., Kaeberlein, M., Andalis, A. A., Sturtz, L. A., Defossez, P. A., Culotta, V. C., Fink, G. R. & Guarente, L. (2002). Calorie restriction extends Saccharomyces cerevisiae life-span by increasing respiration. Nature 418, 344–348.[CrossRef][Medline]
Lin, S. J., Ford, E., Haigis, M., Liszt, G. & Guarente, L. (2004). Calorie restriction extends yeast life span by lowering the level of NADH. Genes Dev 18, 12–16.
Luk, E. E. & Culotta, V. C. (2001). Manganese superoxide dismutase in Saccharomyces cerevisiae acquires its metal co-factor through a pathway involving the Nramp metal transporter, Smf2p. J Biol Chem 276, 47556–47562.
MacLean, M., Harris, N. & Piper, P. W. (2001). Chronological lifespan of stationary phase yeast cells; a model for investigating the factors that might influence the ageing of postmitotic tissues in higher organisms. Yeast 18, 499–509.[CrossRef][Medline]
Martinez-Pastor, M. T., Marchler, G., Schüller, C. S., Marchler-Bauer, A., Ruis, H. & Estruch, F. (1996). The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). EMBO J 15, 2227–2235.[Medline]
Nemoto, S. & Finkel, T. (2002). Redox regulation of forkhead proteins through a p66shc-dependent signaling pathway. Science 295, 2450–2452.
Nyström, T. (2005). Role of oxidative carbonylation in protein quality control and senescence. EMBO J 24, 1311–1317.[CrossRef][Medline]
Piper, P. W. (1995). The heat shock and ethanol stress responses of yeast exhibit extensive similarity and functional overlap. FEMS Microbiol Lett 134, 121–127.[CrossRef][Medline]
Reverter-Branchat, G., Cabiscol, E., Tamarit, J. & Ros, J. (2004). Oxidative damage to specific proteins in replicative and chronological-aged Saccharomyces cerevisiae: common targets and prevention by calorie restriction. J Biol Chem 279, 31983–31989.
Rodriguez-Manzaneque, M. T., Ros, J., Cabiscol, E., Sorribas, A. & Herrero, E. (1999). Grx5 glutaredoxin plays a central role in protection against protein oxidative damage in Saccharomyces cerevisiae. Mol Cell Biol 19, 8180–8190.
Schmitt, A. P. & McEntee, K. (1996). Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 93, 5777–5782.
Sinclair, D. A. (2002). Paradigms and pitfalls of yeast longevity research. Mech Ageing Dev 123, 857–867.[CrossRef][Medline]
Sinclair, D. A. & Guarente, L. (1997). Extrachromosomal rDNA circles – a cause of aging in yeast. Cell 91, 1033–1042.[CrossRef][Medline]
Smith, J. S. & Boeke, J. D. (1997). An unusual form of transcriptional silencing in yeast ribosomal DNA. Genes Dev 11, 241–254.
Sohal, R. S. & Weindruch, R. (1996). Oxidative stress, caloric restriction, and aging. Science 273, 59–63.[Abstract]
Stadtman, E. R. (1992). Protein oxidation and aging. Science 257, 1220–1224.
Stadtman, E. R. & Levine, R. L. (2000). Protein oxidation. Ann N Y Acad Sci 899, 191–208.[Medline]
Stadtman, E. R. & Oliver, C. N. (1991). Metal-catalyzed oxidation of proteins. Physiological consequences. J Biol Chem 266, 2005–2008.
Tamarit, J., Irazusta, V., Moreno-Cermeño, A. & Ros, J. (2006). Colorimetric assay for the quantitation of iron in yeast. Anal Biochem 351, 149–151.[CrossRef][Medline]
Van der Horst, A., Tertoolen, L. G. J., Vries-Smits, L. M. M., Frye, R. A., Medema, R. H. & Burgering, B. M. T. (2004). FOXO4 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2SIRT1. J Biol Chem 279, 28873–28879.
van Voorst, F. V., Houghton-Larsen, J., Jonson, L., Kielland-Brandt, M. C. & Brandt, A. (2006). Genome-wide identification of genes required for growth of Saccharomyces cerevisiae under ethanol stress. Yeast 23, 351–359.[CrossRef][Medline]
Williamson, V. M., Bennetzen, J., Young, E. T., Nasmyth, K. & Hall, B. D. (1980). Isolation of the structural gene for alcohol dehydrogenase by genetic complementation in yeast. Nature 283, 214–216.[CrossRef][Medline]
Received 28 April 2007;
revised 3 July 2007;
accepted 10 July 2007.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
, WT; 
, 2xADH1). Data are presented as mean±SD from three independent experiments.
) and 2xADH1 sir2
) cells grown on YPD medium to oxidative and heat stresses. (a) H2O2 treatment for 60 min; (b) incubation at 48 °C for 10, 20 and 30 min. Viability was measured by counting survivor colonies on YPD plates. (c) Cultures of WT sir2